Loading...

Detail Information of piRNA: piR-hsa-9509

General Information
piRBase Id piR-hsa-9509 Accession DQ579211
Organism Human Number of methods 2
Sequence TGAATGAGGTCTAGGAAATAATTTGC Number of papers 2
Length 26 Golden piRNA -
Aliases piR-47323; PIR40322;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
175 GSM1584529 3 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 5 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 24 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 2 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 2:131049196-131049222:- FAM168B ENST00000389915; FAM168B ENST00000409185;
piRNA Expression
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 1.3342
GSM1584530 2.4544
GSM1584531 2.9471
GSM1584532 2.509
The Expression of piRNA: piR-hsa-9509

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.