Loading...

Detail Information of piRNA: piR-hsa-8629

General Information
piRBase Id piR-hsa-8629 Accession DQ578388
Organism Human Number of methods 2
Sequence TCTTGGCTGAGTCTACAGGCACAACTGCTGCC Number of papers 2
Length 32 Golden piRNA -
Aliases piR-46500; PIR39499;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
265 GSM3517634 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
280 GSM3517660 N/A 31358756 IP Input oocyte(age: adult)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
288 GSM3517673 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
3 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:119409267-119409299:- GTF2IP12 ENST00000651444; GTF2IP12 ENST00000634317; GTF2IP12 ENST00000652280;
Location 2 7:56830743-56830775:- ENSG00000279072 ENST00000624628;
Location 3 7:63746240-63746272:+
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.