Loading...
piRBase Id | piR-hsa-862 | Accession | DQ570597 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | ACGCTGCTGATAAAGACATACCTGAGACTGT | Number of papers | 4 |
Length | 31 | Golden piRNA | - |
Aliases | piR-30709; PIR31708; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
301 | GSM2222675 | N/A | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
327 | GSM4020164 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio |
331 | GSM4020168 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat |
333 | GSM4020170 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d |
334 | GSM4020171 | 2 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d |
335 | GSM4020172 | 3 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d |
336 | GSM4020173 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control |
337 | GSM4020174 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control |
338 | GSM4020175 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat |
339 | GSM4020176 | 1 | 32050423 | small RNA | mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat |
432 | GSM2067755 | 1 | 27068805 | small RNA | Seminal plasma(azoospermia) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 10:91235893-91235924:- | PCGF5 ENST00000614189; PCGF5 ENST00000543648; PCGF5 ENST00000336126; | LTR ERVL-MaLR THE1B; |
Location 2 | 2:178521814-178521845:+ | TTN-AS1 ENST00000585625; | LTR ERVL-MaLR THE1B; |
Location 3 | 8:70867023-70867054:+ | ENSG00000285579 ENST00000647843; | LTR ERVL-MaLR THE1B; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 32050423 | Journal | Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398. |
---|---|---|---|
Title | Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells. | ||
Authors | Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |