Loading...
| piRBase Id | piR-hsa-8455265 | Accession | N/A |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | TGCCGATCGGGTGTCCGCACTAAGTT | Number of papers | 1 |
| Length | 26 | Golden piRNA | - |
| Aliases | N/A | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 14:49586675-49586701:+ | RPS29 ENST00000556230; RPS29 ENST00000557111; RN7SL1 ENST00000618786; | srpRNA srpRNA 7SLRNA; |
| Location 2 | 14:49862727-49862753:- | ENSG00000282885 ENST00000635177; ENSG00000282885 ENST00000668702; ENSG00000282885 ENST00000659240; ENSG00000282885 ENST00000655317; ENSG00000282885 ENST00000634923; RN7SL2 ENST00000490232; | srpRNA srpRNA 7SLRNA; |
| Location 3 | 2:11584868-11584894:+ | GREB1 ENST00000381486; GREB1 ENST00000263834; GREB1 ENST00000381483; GREB1 ENST00000234142; RN7SL674P ENST00000463397; | srpRNA srpRNA 7SLRNA; |
| Location 4 | 20:50557858-50557884:- | PTPN1 ENST00000541713; PTPN1 ENST00000371621; RN7SL672P ENST00000474091; | srpRNA srpRNA 7SLRNA; |
| Location 5 | 3:15738610-15738636:+ | ANKRD28 ENST00000399451; ANKRD28 ENST00000624145; ANKRD28 ENST00000683139; ANKRD28 ENST00000412318; ANKRD28 ENST00000497037; ANKRD28 ENST00000451422; ANKRD28 ENST00000498524; ANKRD28 ENST00000476472; ANKRD28 ENST00000460278; ANKRD28 ENST00000439830; RN7SL4P ENST00000584058; | LTR ERVK MER11B; |
| Location 6 | 6:20421765-20421791:- | E2F3 ENST00000346618; E2F3 ENST00000613242; E2F3 ENST00000535432; RN7SL128P ENST00000467883; | srpRNA srpRNA 7SLRNA; |
| Location 7 | 9:9442155-9442181:+ | PTPRD ENST00000381196; PTPRD ENST00000463477; RN7SL5P ENST00000581458; | srpRNA srpRNA 7SLRNA; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 33322418 | Journal | Int J Mol Sci. 2020 Dec 11;21(24):9439. doi: 10.3390/ijms21249439. |
|---|---|---|---|
| Title | Trypanosoma cruzi Modulates PIWI-Interacting RNA Expression in Primary Human Cardiac Myocytes during the Early Phase of Infection. | ||
| Authors | Rayford KJ, Cooley A, Arun A, Rachakonda G, Kleschenko Y, Villalta F, Pratap S, Lima MF, Nde PN. | ||