Loading...
| piRBase Id | piR-hsa-8450248 | Accession | N/A |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | AGGTGGGAGGATCGCTTGAGCCCAG | Number of papers | 1 |
| Length | 25 | Golden piRNA | - |
| Aliases | N/A | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 1:45544616-45544641:+ | SINE Alu AluJb; | |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 33322418 | Journal | Int J Mol Sci. 2020 Dec 11;21(24):9439. doi: 10.3390/ijms21249439. |
|---|---|---|---|
| Title | Trypanosoma cruzi Modulates PIWI-Interacting RNA Expression in Primary Human Cardiac Myocytes during the Early Phase of Infection. | ||
| Authors | Rayford KJ, Cooley A, Arun A, Rachakonda G, Kleschenko Y, Villalta F, Pratap S, Lima MF, Nde PN. | ||