Loading...
| piRBase Id | piR-hsa-8447388 | Accession | N/A |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | GTGTATGTGCTTGGCTGAGGAGCCA | Number of papers | 1 |
| Length | 25 | Golden piRNA | - |
| Aliases | N/A | ||
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 21:8218502-8218527:+ | ENSG00000278996 ENST00000623664; | rRNA rRNA LSU-rRNA_Hsa; |
| Location 2 | 21:8401540-8401565:+ | ENSG00000280441 ENST00000623860; ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; ENSG00000280441 ENST00000651958; | rRNA rRNA LSU-rRNA_Hsa; |
| Location 3 | 21:8445772-8445797:+ | ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; | rRNA rRNA LSU-rRNA_Hsa; |
| Location 4 | 7:48632776-48632801:+ | ABCA13 ENST00000435803; ABCA13 ENST00000544596; ABCA13 ENST00000453246; ABCA13 ENST00000411975; | rRNA rRNA LSU-rRNA_Hsa; |
| Location 5 | CHR_HG2513_PATCH:8759636-8759661:+ | ||
| Location 6 | CHR_HG2513_PATCH:8803868-8803893:+ | ||
| Location 7 | GL000220.1:117977-118002:+ | ||
| Location 8 | KI270733.1:134840-134865:+ |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 33322418 | Journal | Int J Mol Sci. 2020 Dec 11;21(24):9439. doi: 10.3390/ijms21249439. |
|---|---|---|---|
| Title | Trypanosoma cruzi Modulates PIWI-Interacting RNA Expression in Primary Human Cardiac Myocytes during the Early Phase of Infection. | ||
| Authors | Rayford KJ, Cooley A, Arun A, Rachakonda G, Kleschenko Y, Villalta F, Pratap S, Lima MF, Nde PN. | ||