Loading...

Detail Information of piRNA: piR-hsa-820

General Information
piRBase Id piR-hsa-820 Accession DQ570540
Organism Human Number of methods 1
Sequence ACCTGATGTTACATTGTAGTGTGCTGATG Number of papers 2
Length 29 Golden piRNA -
Aliases piR-30652; PIR31651;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
300 GSM2222674 555 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 5705 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 2:231460373-231460402:- NCL ENST00000461347; NCL ENST00000322723; NCL ENST00000676514; NCL ENST00000677703; NCL ENST00000678828; NCL ENST00000676798; NCL ENST00000678246; NCL ENST00000679348; NCL ENST00000417652; NCL ENST00000453992; NCL ENST00000678849; NCL ENST00000678729; NCL ENST00000678405; NCL ENST00000678364; NCL ENST00000678131; NCL ENST00000676913; NCL ENST00000676690; NCL ENST00000356936; NCL ENST00000454824; NCL ENST00000436894; NCL ENST00000677786; NCL ENST00000494618; SNORD82 ENST00000365530;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.