Loading...

Detail Information of piRNA: piR-hsa-8031

General Information
piRBase Id piR-hsa-8031 Accession DQ577772
Organism Human Number of methods 2
Sequence TCTGAGGGTCCAGGGTTCATGTCCCTGT Number of papers 5
Length 28 Golden piRNA Y
Aliases piR-45884; PIR38883;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
168 GSM1584522 2 25818294 small RNA adult ovary
169 GSM1584523 8 25818294 oxidized small RNA adult ovary
170 GSM1584524 6 25818294 oxidized small RNA adult ovary
300 GSM2222674 42 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 307 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
308 GSM4585041 44 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
430 GSM2067753 2 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 4 27068805 small RNA Seminal plasma(asthenozoospermia)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 14:73588831-73588859:- ENSG00000258603 ENST00000664243; tRNA tRNA tRNA-Lys-AAA;
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 1.3806
GSM1584523 7.6143
GSM1584524 5.2321
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-8031
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.