Loading...

Detail Information of piRNA: piR-hsa-7193

General Information
piRBase Id piR-hsa-7193 Accession DQ576872
Organism Human Number of methods 1
Sequence TCGCCGTGATCGTATAGTGGTTAGTACTCTG Number of papers 6
Length 31 Golden piRNA -
Aliases piR-44984; PIR37983;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
289 GSM1386593 54520 26095918 samll RNA Lung(cell line: HBE2; cell type: Immortalized bronchial epithelial)
290 GSM1386594 25388 26095918 samll RNA Lung(cell line: HBE3; cell type: Immortalized bronchial epithelial)
291 GSM1386595 40541 26095918 samll RNA Lung(cell line: HBE4; cell type: Immortalized bronchial epithelial)
292 GSM1386596 41417 26095918 samll RNA Lung(cell line: H522; cell type: Adenocarcinoma (NSCLC))
293 GSM1386597 19737 26095918 samll RNA Lung(cell line: H1437; cell type: Adenocarcinoma (NSCLC))
294 GSM1386598 11361 26095918 samll RNA Lung(cell line: H1792; cell type: Adenocarcinoma (NSCLC))
295 GSM1386599 4675 26095918 samll RNA Lung(cell line: H1944; cell type: Adenocarcinoma (NSCLC))
296 GSM1386600 38002 26095918 samll RNA Lung(cell line: H157; cell type: Squamous (NSCLC))
297 GSM1386601 17042 26095918 samll RNA Lung(cell line: H226; cell type: Squamous (NSCLC))
298 GSM1386602 30086 26095918 samll RNA Lung(cell line: H596; cell type: Squamous (NSCLC))
299 GSM1386603 16209 26095918 samll RNA Lung(cell line: SKMES1; cell type: Squamous (NSCLC))
300 GSM2222674 5092 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 24431 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
302 GSM4585035 663 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
303 GSM4585036 978 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
304 GSM4585037 230 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
305 GSM4585038 321 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
306 GSM4585039 350 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
307 GSM4585040 490 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
308 GSM4585041 1607 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
309 GSM4585042 532 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
310 GSM4585043 795 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
311 GSM4585044 582 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
312 GSM4585045 872 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
313 GSM4585046 772 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
314 GSM4585047 266 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
315 GSM4585048 173 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
316 GSM4585049 217 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
317 GSM4585050 156 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
318 GSM4585051 220 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
320 GSM4020157 77 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
321 GSM4020158 101 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 137 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 111 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
324 GSM4020161 181 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Femal; Monolayer culture contro
325 GSM4020162 161 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 158 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 139 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
328 GSM4020165 195 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
329 GSM4020166 117 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 164 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 118 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 552 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 949 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 832 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 1257 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 789 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 650 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 351 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 648 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 155 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 297 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 76 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 79 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
430 GSM2067753 1 27068805 small RNA Seminal plasma(fertile healthy)
Location in GRCh38
7 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:146038041-146038072:+ tRNA tRNA tRNA-His-CAY_;
Location 2 1:148281362-148281393:+ tRNA tRNA tRNA-His-CAY_;
Location 3 1:148302776-148302807:- LINC01138 ENST00000640832; LINC01138 ENST00000638958; LINC01138 ENST00000652758; ENSG00000224481 ENST00000648583; tRNA tRNA tRNA-His-CAY_;
Location 4 15:45198648-45198679:- SHF ENST00000290894; ENSG00000259519 ENST00000560034; SHF ENST00000561278; ENSG00000259932 ENST00000568314; tRNA tRNA tRNA-His-CAY_;
Location 5 15:45200455-45200486:- SHF ENST00000290894; SHF ENST00000561278; ENSG00000260035 ENST00000563103; tRNA tRNA tRNA-His-CAY_;
Location 6 15:45201148-45201179:+ SHF ENST00000290894; tRNA tRNA tRNA-His-CAY_;
Location 7 2:224934103-224934134:+ DOCK10 ENST00000258390; DOCK10 ENST00000409592; DOCK10 ENST00000645028; DOCK10 ENST00000644695; DOCK10 ENST00000492369; DOCK10 ENST00000474102; DOCK10 ENST00000435582; tRNA tRNA tRNA-His-CAY_;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
Id in article Disease Subtype Expression Function PubMed
piR-4987 breast cancer up-regulated FC 7.46 23229900
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 26095918 Journal Nat Commun. 2015 Jun 22;6:7316. doi: 10.1038/ncomms8316.
Title A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells.
Authors Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.
PubMed 23229900 Journal Clin Transl Oncol. 2013 Jul;15(7):563-8. doi: 10.1007/s12094-012-0966-0. Epub 2012 Nov 15.
Title Altered expression of piRNAs and their relation with clinicopathologic features of breast cancer.
Authors Huang G, Hu H, Xue X, Shen S, Gao E, Guo G, Shen X, Zhang X.