Loading...

Detail Information of piRNA: piR-hsa-71

General Information
piRBase Id piR-hsa-71 Accession DQ594991
Organism Human Number of methods 1
Sequence TTGATGGTAACAGTAGGTAGTAGGTCAGG Number of papers 3
Length 29 Golden piRNA -
Aliases piR-61103; PIR193194; PIR56102;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
2 N/A N/A 16751777 small RNA testis
430 GSM2067753 64 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 1 27068805 small RNA Seminal plasma(asthenozoospermia)
432 GSM2067755 1 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 15:62239073-62239102:+ ENSG00000166104 ENST00000561706; ENSG00000166104 ENST00000563606;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.