Loading...

Detail Information of piRNA: piR-hsa-7062

General Information
piRBase Id piR-hsa-7062 Accession DQ576726
Organism Human Number of methods 2
Sequence TCCTTGTTCCAAATGTGACCCGATGTTTGC Number of papers 3
Length 30 Golden piRNA Y
Aliases piR-44838; PIR37837;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 1 25818294 small RNA adult ovary
171 GSM1584525 1 25818294 small RNA ovary from 1st trimester embryos
175 GSM1584529 3 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 5 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 40 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 2 25818294 oxidized small RNA ovary from 2nd trimester embryos
266 GSM3517635 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10133156-10133186:+
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0.6307
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 1.3342
GSM1584530 2.4544
GSM1584531 4.9119
GSM1584532 2.509
The Expression of piRNA: piR-hsa-7062
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.