Loading...

Detail Information of piRNA: piR-hsa-65

General Information
piRBase Id piR-hsa-65 Accession N/A
Organism Human Number of methods 1
Sequence TGAATTAGCAAAACTGACTGGTAGGC Number of papers 2
Length 26 Golden piRNA -
Aliases PIR193188;
Datasets
Dataset Accession Reads PubMed Method Tissue
2 N/A N/A 16751777 small RNA testis
3 N/A 1 22313525 small RNA epididymis
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 6:33902084-33902110:+ ENSG00000233183 ENST00000666355; ENSG00000233183 ENST00000669489; ENSG00000233183 ENST00000660038; ENSG00000233183 ENST00000665879; ENSG00000233183 ENST00000662210; ENSG00000233183 ENST00000661015; ENSG00000233183 ENST00000663283; ENSG00000233183 ENST00000526556; ENSG00000233183 ENST00000668149; ENSG00000233183 ENST00000659918; ENSG00000233183 ENST00000669531; ENSG00000233183 ENST00000451317; ENSG00000233183 ENST00000655159; ENSG00000233183 ENST00000667529;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 22313525 Journal Gene. 2012 Apr 15;497(2):330-5.
Title Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Authors Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.