Loading...
piRBase Id | piR-hsa-65 | Accession | N/A |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | TGAATTAGCAAAACTGACTGGTAGGC | Number of papers | 2 |
Length | 26 | Golden piRNA | - |
Aliases | PIR193188; |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 6:33902084-33902110:+ | ENSG00000233183 ENST00000666355; ENSG00000233183 ENST00000669489; ENSG00000233183 ENST00000660038; ENSG00000233183 ENST00000665879; ENSG00000233183 ENST00000662210; ENSG00000233183 ENST00000661015; ENSG00000233183 ENST00000663283; ENSG00000233183 ENST00000526556; ENSG00000233183 ENST00000668149; ENSG00000233183 ENST00000659918; ENSG00000233183 ENST00000669531; ENSG00000233183 ENST00000451317; ENSG00000233183 ENST00000655159; ENSG00000233183 ENST00000667529; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751777 | Journal | Nature. 2006 Jul 13;442(7099):203-7. |
---|---|---|---|
Title | A novel class of small RNAs bind to MILI protein in mouse testes | ||
Authors | Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T. |
PubMed | 22313525 | Journal | Gene. 2012 Apr 15;497(2):330-5. |
---|---|---|---|
Title | Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis. | ||
Authors | Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY. |