Loading...

Detail Information of piRNA: piR-hsa-6299

General Information
piRBase Id piR-hsa-6299 Accession DQ576036
Organism Human Number of methods 2
Sequence TCCTACGTGGAAAAGATGACTGAATTGCTGC Number of papers 3
Length 31 Golden piRNA Y
Aliases piR-44148; PIR37147;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 12 25818294 small RNA adult ovary
168 GSM1584522 10 25818294 small RNA adult ovary
169 GSM1584523 88 25818294 oxidized small RNA adult ovary
170 GSM1584524 59 25818294 oxidized small RNA adult ovary
171 GSM1584525 1 25818294 small RNA ovary from 1st trimester embryos
175 GSM1584529 48 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 24 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 392 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 11 25818294 oxidized small RNA ovary from 2nd trimester embryos
269 GSM3517638 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
273 GSM3517643 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
276 GSM3517646 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
278 GSM3517648 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
279 GSM3517649 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
287 GSM3517672 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
288 GSM3517673 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10130074-10130105:+
piRNA Expression
Sample CPM
GSM1584521 10.7846
GSM1584522 6.9031
GSM1584523 83.7574
GSM1584524 51.449
GSM1584525 0.6307
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 21.3476
GSM1584530 11.781
GSM1584531 48.1361
GSM1584532 13.7995
The Expression of piRNA: piR-hsa-6299
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.