Loading...

Detail Information of piRNA: piR-hsa-6298

General Information
piRBase Id piR-hsa-6298 Accession DQ576035
Organism Human Number of methods 2
Sequence TCCTACGTGGAAAAGATGACTGAATTGCTG Number of papers 3
Length 30 Golden piRNA Y
Aliases piR-44147; PIR37146;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
168 GSM1584522 3 25818294 small RNA adult ovary
169 GSM1584523 20 25818294 oxidized small RNA adult ovary
170 GSM1584524 16 25818294 oxidized small RNA adult ovary
171 GSM1584525 1 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 6 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 40 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
278 GSM3517648 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
287 GSM3517672 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10130074-10130104:+
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 2.0709
GSM1584523 19.0358
GSM1584524 13.9523
GSM1584525 0.6307
GSM1584526 0
Sample CPM
GSM1584527 1.4384
GSM1584528 0
GSM1584529 2.6684
GSM1584530 0
GSM1584531 4.9119
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-6298
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.