Loading...
piRBase Id | piR-hsa-6148 | Accession | DQ575885 |
---|---|---|---|
Organism | Human | Number of methods | 2 |
Sequence | TCCGTAGTGTAGTGGTTATCACTTTCGCCT | Number of papers | 4 |
Length | 30 | Golden piRNA | - |
Aliases | piR-43997; PIR36996; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
167 | GSM1584521 | 7 | 25818294 | small RNA | adult ovary |
168 | GSM1584522 | 16 | 25818294 | small RNA | adult ovary |
170 | GSM1584524 | 2 | 25818294 | oxidized small RNA | adult ovary |
171 | GSM1584525 | 12 | 25818294 | small RNA | ovary from 1st trimester embryos |
173 | GSM1584527 | 1 | 25818294 | oxidized small RNA | ovary from 1st trimester embryos |
175 | GSM1584529 | 10 | 25818294 | small RNA | ovary from 2nd trimester embryos |
176 | GSM1584530 | 27 | 25818294 | small RNA | ovary from 2nd trimester embryos |
300 | GSM2222674 | 346 | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
301 | GSM2222675 | 2124 | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
430 | GSM2067753 | 5 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
432 | GSM2067755 | 3 | 27068805 | small RNA | Seminal plasma(azoospermia) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 6:27681145-27681175:- | tRNA tRNA tRNA-Val-GTY; | |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
Sample | CPM |
---|---|
GSM1584521 | 6.291 |
GSM1584522 | 11.045 |
GSM1584523 | 0 |
GSM1584524 | 1.744 |
GSM1584525 | 7.569 |
GSM1584526 | 0 |
Sample | CPM |
---|---|
GSM1584527 | 1.4384 |
GSM1584528 | 0 |
GSM1584529 | 4.4474 |
GSM1584530 | 13.2536 |
GSM1584531 | 0 |
GSM1584532 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 25818294 | Journal | Cell Rep. 2015 Mar 31;10(12):2069-82. |
---|---|---|---|
Title | Piwi proteins and piRNAs in mammalian oocytes and early embryos. | ||
Authors | Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |