Loading...

Detail Information of piRNA: piR-hsa-6148

General Information
piRBase Id piR-hsa-6148 Accession DQ575885
Organism Human Number of methods 2
Sequence TCCGTAGTGTAGTGGTTATCACTTTCGCCT Number of papers 4
Length 30 Golden piRNA -
Aliases piR-43997; PIR36996;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 7 25818294 small RNA adult ovary
168 GSM1584522 16 25818294 small RNA adult ovary
170 GSM1584524 2 25818294 oxidized small RNA adult ovary
171 GSM1584525 12 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 10 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 27 25818294 small RNA ovary from 2nd trimester embryos
300 GSM2222674 346 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 2124 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
430 GSM2067753 5 27068805 small RNA Seminal plasma(fertile healthy)
432 GSM2067755 3 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
18 best hit(s) with 1 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 6:27681145-27681175:- tRNA tRNA tRNA-Val-GTY;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 6.291
GSM1584522 11.045
GSM1584523 0
GSM1584524 1.744
GSM1584525 7.569
GSM1584526 0
Sample CPM
GSM1584527 1.4384
GSM1584528 0
GSM1584529 4.4474
GSM1584530 13.2536
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-6148
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.