Loading...
piRBase Id | piR-hsa-608 | Accession | DQ570299 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | ACAGAACCTCATGGTACGGAACCACCAGG | Number of papers | 2 |
Length | 29 | Golden piRNA | - |
Aliases | piR-30411; PIR31410; |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 6:33896474-33896503:+ | LINC01016 ENST00000506222; ENSG00000233183 ENST00000666355; LINC01016 ENST00000533304; ENSG00000233183 ENST00000669489; ENSG00000233183 ENST00000660038; ENSG00000233183 ENST00000665879; ENSG00000233183 ENST00000662210; ENSG00000233183 ENST00000661015; ENSG00000233183 ENST00000663283; ENSG00000233183 ENST00000526556; ENSG00000233183 ENST00000668149; ENSG00000233183 ENST00000659918; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22313525 | Journal | Gene. 2012 Apr 15;497(2):330-5. |
---|---|---|---|
Title | Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis. | ||
Authors | Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY. |