Loading...
| piRBase Id | piR-hsa-6024 | Accession | DQ575746 |
|---|---|---|---|
| Organism | Human | Number of methods | 2 |
| Sequence | TCCGAGATGATGAACTCCGGGGTCTGAGAGT | Number of papers | 3 |
| Length | 31 | Golden piRNA | Y |
| Aliases | piR-43858; PIR36857; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 1 | N/A | N/A | 16751776 | small RNA | testis |
| 167 | GSM1584521 | 1 | 25818294 | small RNA | adult ovary |
| 169 | GSM1584523 | 16 | 25818294 | oxidized small RNA | adult ovary |
| 170 | GSM1584524 | 11 | 25818294 | oxidized small RNA | adult ovary |
| 175 | GSM1584529 | 6 | 25818294 | small RNA | ovary from 2nd trimester embryos |
| 176 | GSM1584530 | 10 | 25818294 | small RNA | ovary from 2nd trimester embryos |
| 177 | GSM1584531 | 34 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
| 178 | GSM1584532 | 4 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
| 430 | GSM2067753 | 1 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
| 431 | GSM2067754 | 10 | 27068805 | small RNA | Seminal plasma(asthenozoospermia) |
| 432 | GSM2067755 | 3 | 27068805 | small RNA | Seminal plasma(azoospermia) |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 15:82472200-82472231:- | CSPG4P10 ENST00000612093; ENSG00000278603 ENST00000617986; | |
| Location 2 | 15:84199569-84199600:- | GOLGA2P7 ENST00000400817; GOLGA2P7 ENST00000559668; GOLGA2P7 ENST00000316967; | |
| Location 3 | 15:84473956-84473987:+ | ||
| Location 4 | 15:85204167-85204198:- | ENSG00000229212 ENST00000648573; CSPG4P12 ENST00000559989; | |
| Location 5 | CHR_HSCHR15_5_CTG8:82385846-82385877:+ | ||
| Location 6 | CHR_HSCHR15_5_CTG8:82551260-82551291:- |
| Sample | CPM |
|---|---|
| GSM1584521 | 0.8987 |
| GSM1584522 | 0 |
| GSM1584523 | 15.2286 |
| GSM1584524 | 9.5922 |
| GSM1584525 | 0 |
| GSM1584526 | 0 |
| Sample | CPM |
|---|---|
| GSM1584527 | 0 |
| GSM1584528 | 0 |
| GSM1584529 | 2.6684 |
| GSM1584530 | 4.9087 |
| GSM1584531 | 4.1751 |
| GSM1584532 | 5.018 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 25818294 | Journal | Cell Rep. 2015 Mar 31;10(12):2069-82. |
|---|---|---|---|
| Title | Piwi proteins and piRNAs in mammalian oocytes and early embryos. | ||
| Authors | Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF. | ||
| PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
|---|---|---|---|
| Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
| Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. | ||