Loading...

Detail Information of piRNA: piR-hsa-6024

General Information
piRBase Id piR-hsa-6024 Accession DQ575746
Organism Human Number of methods 2
Sequence TCCGAGATGATGAACTCCGGGGTCTGAGAGT Number of papers 3
Length 31 Golden piRNA Y
Aliases piR-43858; PIR36857;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 1 25818294 small RNA adult ovary
169 GSM1584523 16 25818294 oxidized small RNA adult ovary
170 GSM1584524 11 25818294 oxidized small RNA adult ovary
175 GSM1584529 6 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 10 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 34 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 4 25818294 oxidized small RNA ovary from 2nd trimester embryos
430 GSM2067753 1 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 10 27068805 small RNA Seminal plasma(asthenozoospermia)
432 GSM2067755 3 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
6 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 15:82472200-82472231:- CSPG4P10 ENST00000612093; ENSG00000278603 ENST00000617986;
Location 2 15:84199569-84199600:- GOLGA2P7 ENST00000400817; GOLGA2P7 ENST00000559668; GOLGA2P7 ENST00000316967;
Location 3 15:84473956-84473987:+
Location 4 15:85204167-85204198:- ENSG00000229212 ENST00000648573; CSPG4P12 ENST00000559989;
Location 5 CHR_HSCHR15_5_CTG8:82385846-82385877:+
Location 6 CHR_HSCHR15_5_CTG8:82551260-82551291:-
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 0
GSM1584523 15.2286
GSM1584524 9.5922
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 2.6684
GSM1584530 4.9087
GSM1584531 4.1751
GSM1584532 5.018
The Expression of piRNA: piR-hsa-6024
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.