Loading...

Detail Information of piRNA: piR-hsa-5936

General Information
piRBase Id piR-hsa-5936 Accession DQ575658
Organism Human Number of methods 2
Sequence TCCCTGGTGGTCTAGTGGTTAGGATA Number of papers 6
Length 26 Golden piRNA Y
Aliases piR-43770; PIR36769;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
167 GSM1584521 6 25818294 small RNA adult ovary
168 GSM1584522 8 25818294 small RNA adult ovary
169 GSM1584523 52 25818294 oxidized small RNA adult ovary
170 GSM1584524 61 25818294 oxidized small RNA adult ovary
171 GSM1584525 7 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 4 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 28 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 1 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 3 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 11 25818294 oxidized small RNA ovary from 2nd trimester embryos
289 GSM1386593 15 26095918 samll RNA Lung(cell line: HBE2; cell type: Immortalized bronchial epithelial)
290 GSM1386594 1 26095918 samll RNA Lung(cell line: HBE3; cell type: Immortalized bronchial epithelial)
291 GSM1386595 7 26095918 samll RNA Lung(cell line: HBE4; cell type: Immortalized bronchial epithelial)
292 GSM1386596 9 26095918 samll RNA Lung(cell line: H522; cell type: Adenocarcinoma (NSCLC))
293 GSM1386597 6 26095918 samll RNA Lung(cell line: H1437; cell type: Adenocarcinoma (NSCLC))
295 GSM1386599 3 26095918 samll RNA Lung(cell line: H1944; cell type: Adenocarcinoma (NSCLC))
296 GSM1386600 3 26095918 samll RNA Lung(cell line: H157; cell type: Squamous (NSCLC))
297 GSM1386601 9 26095918 samll RNA Lung(cell line: H226; cell type: Squamous (NSCLC))
298 GSM1386602 2 26095918 samll RNA Lung(cell line: H596; cell type: Squamous (NSCLC))
299 GSM1386603 8 26095918 samll RNA Lung(cell line: SKMES1; cell type: Squamous (NSCLC))
300 GSM2222674 444 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 2392 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
320 GSM4020157 272 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
321 GSM4020158 731 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
322 GSM4020159 274 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
323 GSM4020160 387 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
324 GSM4020161 544 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Femal; Monolayer culture contro
325 GSM4020162 884 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 334 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 190 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
328 GSM4020165 216 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
329 GSM4020166 374 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 902 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 1033 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 39 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 66 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 107 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 140 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 124 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 196 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 254 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 288 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 152 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 340 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 338 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 144 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
430 GSM2067753 4028 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 1687 27068805 small RNA Seminal plasma(asthenozoospermia)
432 GSM2067755 3440 27068805 small RNA Seminal plasma(azoospermia)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 5:139760973-139760999:+ Simple_repeat Simple_repeat (ATAA)n;
piRNA Expression
Sample CPM
GSM1584521 5.3923
GSM1584522 5.5225
GSM1584523 49.493
GSM1584524 53.1931
GSM1584525 4.4152
GSM1584526 2.5898
Sample CPM
GSM1584527 40.2744
GSM1584528 0
GSM1584529 0.4447
GSM1584530 1.4726
GSM1584531 1.3508
GSM1584532 0
The Expression of piRNA: piR-hsa-5936
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 26095918 Journal Nat Commun. 2015 Jun 22;6:7316. doi: 10.1038/ncomms8316.
Title A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells.
Authors Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.