Loading...

Detail Information of piRNA: piR-hsa-582561

General Information

piRBase Id	piR-hsa-582561	Accession	N/A
Organism	Human	Number of methods	1
Sequence	ATTCCAGGCGTGAGCTGCTGCACC	Number of papers	1
Length	24	Golden piRNA	-
Aliases	N/A

Datasets

Dataset	Accession	Reads	PubMed	Method	Tissue
169	GSM1584523	1	25818294	oxidized small RNA	adult ovary

Location in GRCh38

1 best hit(s) with 0 mismatch(es) in GRCh38

No.	Location	Gene	RepeatMaker
Location 1	1:1673392-1673416:-	SLC35E2B ENST00000614300; SLC35E2B ENST00000617444; SLC35E2B ENST00000611123; SLC35E2B ENST00000481276; ENSG00000269737 ENST00000596308; ENSG00000269737 ENST00000597891;	SINE Alu AluSg;

piRNA Expression

Sample	CPM
GSM1584521	0
GSM1584522	0
GSM1584523	0.9518
GSM1584524	0
GSM1584525	0
GSM1584526	0

Sample	CPM
GSM1584527	0
GSM1584528	0
GSM1584529	0
GSM1584530	0
GSM1584531	0
GSM1584532	0

The Expression of piRNA: piR-hsa-582561

Loading...

P value calculation

Sample1

Sample2

Target mRNA

No record.

Target lncRNA

No record.

Target Network

No record.

Disease Information

No record.

Reference

PubMed	25818294	Journal	Cell Rep. 2015 Mar 31;10(12):2069-82.
Title	Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors	Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.