Loading...

Detail Information of piRNA: piR-hsa-57533

General Information
piRBase Id piR-hsa-57533 Accession N/A
Organism Human Number of methods 1
Sequence AAAGGCTTCCCTCCACCCCGCCCC Number of papers 1
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 2:131050988-131051012:- FAM168B ENST00000389915; FAM168B ENST00000409185;
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-57533
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.