Loading...

Detail Information of piRNA: piR-hsa-572510

General Information
piRBase Id piR-hsa-572510 Accession N/A
Organism Human Number of methods 1
Sequence GGAGCCTCAACCATCCGAAGCAGC Number of papers 1
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
169 GSM1584523 1 25818294 oxidized small RNA adult ovary
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:173886519-173886543:+ ZBTB37 ENST00000367704; ZBTB37 ENST00000427304; ZBTB37 ENST00000367701;
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0.9518
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-572510
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.