Loading...
piRBase Id | piR-hsa-56 | Accession | DQ591700 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | TGTGCATTGTGATCGTCTGAAGGAAGAGC | Number of papers | 3 |
Length | 29 | Golden piRNA | - |
Aliases | piR-58812; PIR193179; PIR52811; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
2 | N/A | N/A | 16751777 | small RNA | testis |
430 | GSM2067753 | 6 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
431 | GSM2067754 | 3 | 27068805 | small RNA | Seminal plasma(asthenozoospermia) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 6:33891469-33891498:- | LINC01016 ENST00000525912; LINC01016 ENST00000656906; LINC01016 ENST00000661137; LINC01016 ENST00000671143; LINC01016 ENST00000506222; LINC01016 ENST00000659818; ENSG00000233183 ENST00000666355; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 16751777 | Journal | Nature. 2006 Jul 13;442(7099):203-7. |
---|---|---|---|
Title | A novel class of small RNAs bind to MILI protein in mouse testes | ||
Authors | Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |