Loading...

Detail Information of piRNA: piR-hsa-5388

General Information
piRBase Id piR-hsa-5388 Accession DQ575082
Organism Human Number of methods 2
Sequence TCCCACAGTGCTGTATCTGACTAGGTAGC Number of papers 3
Length 29 Golden piRNA Y
Aliases piR-43194; PIR36193;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
169 GSM1584523 2 25818294 oxidized small RNA adult ovary
170 GSM1584524 9 25818294 oxidized small RNA adult ovary
175 GSM1584529 1 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 2 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 12 25818294 oxidized small RNA ovary from 2nd trimester embryos
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
269 GSM3517638 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
276 GSM3517646 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
279 GSM3517649 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
280 GSM3517660 N/A 31358756 IP Input oocyte(age: adult)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10127054-10127083:+
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 1.9036
GSM1584524 7.8482
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0.4447
GSM1584530 0.9817
GSM1584531 1.4736
GSM1584532 0
The Expression of piRNA: piR-hsa-5388
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.