Loading...
piRBase Id | piR-hsa-5293 | Accession | DQ574987 |
---|---|---|---|
Organism | Human | Number of methods | 2 |
Sequence | TCCCAAAGTGCCGAGATTGCAGCCTCTGC | Number of papers | 4 |
Length | 29 | Golden piRNA | - |
Aliases | piR-43099; PIR36098; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
288 | GSM3517673 | N/A | 31358756 | oxidized small RNA | oocyte(age: adult; spike in) |
301 | GSM2222675 | N/A | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
430 | GSM2067753 | 1 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 4:82077499-82077528:+ | Retroposon SVA SVA_B; | |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 31358756 | Journal | Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8. |
---|---|---|---|
Title | Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes. | ||
Authors | Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |