Loading...
piRBase Id | piR-hsa-522 | Accession | DQ570213 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | AATTGGATCACACATGGGCTTGGAGA | Number of papers | 3 |
Length | 26 | Golden piRNA | - |
Aliases | piR-30325; PIR31324; |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 5:79076063-79076089:+ | DMGDH ENST00000520388; BHMT2 ENST00000255192; BHMT2 ENST00000521567; BHMT2 ENST00000518666; BHMT2 ENST00000518758; BHMT2 ENST00000519743; BHMT2 ENST00000523472; | LTR ERV1 LTR1A1; |
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22313525 | Journal | Gene. 2012 Apr 15;497(2):330-5. |
---|---|---|---|
Title | Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis. | ||
Authors | Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |