Loading...

Detail Information of piRNA: piR-hsa-522

General Information
piRBase Id piR-hsa-522 Accession DQ570213
Organism Human Number of methods 1
Sequence AATTGGATCACACATGGGCTTGGAGA Number of papers 3
Length 26 Golden piRNA -
Aliases piR-30325; PIR31324;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
3 N/A 1 22313525 small RNA epididymis
430 GSM2067753 8 27068805 small RNA Seminal plasma(fertile healthy)
Location in GRCh38
16 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 5:79076063-79076089:+ DMGDH ENST00000520388; BHMT2 ENST00000255192; BHMT2 ENST00000521567; BHMT2 ENST00000518666; BHMT2 ENST00000518758; BHMT2 ENST00000519743; BHMT2 ENST00000523472; LTR ERV1 LTR1A1;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22313525 Journal Gene. 2012 Apr 15;497(2):330-5.
Title Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Authors Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.