Loading...

Detail Information of piRNA: piR-hsa-510570

General Information
piRBase Id piR-hsa-510570 Accession N/A
Organism Human Number of methods 1
Sequence CTTCACATGTGTCAGAATGGGACT Number of papers 1
Length 24 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
169 GSM1584523 1 25818294 oxidized small RNA adult ovary
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 2:97562741-97562765:- ANKRD36B ENST00000359901; ANKRD36B ENST00000438709; ANKRD36B ENST00000258459; ANKRD36B ENST00000443455; ANKRD36B ENST00000419390;
piRNA Expression
The Expression of piRNA: piR-hsa-510570
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.