Loading...
piRBase Id | piR-hsa-5006 | Accession | DQ574671 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | TCCAGGCCCAGAATGTCCTTAACTCAGCATC | Number of papers | 1 |
Length | 31 | Golden piRNA | - |
Aliases | piR-42783; PIR35782; |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 1:222475660-222475691:- |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |