Loading...
| piRBase Id | piR-hsa-4946 | Accession | DQ576604 |
|---|---|---|---|
| Organism | Human | Number of methods | 1 |
| Sequence | TCCTTAGGTCGCTGGTTCGAATCCGGCTCGAA | Number of papers | 2 |
| Length | 32 | Golden piRNA | - |
| Aliases | piR-44716; PIR37715; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 1 | N/A | N/A | 16751776 | small RNA | testis |
| 300 | GSM2222674 | 23 | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
| 301 | GSM2222675 | 264 | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 6:26568913-26568945:+ | tRNA tRNA tRNA-Tyr-TAC; | |
| Location 2 | 6:26575624-26575656:+ | tRNA tRNA tRNA-Tyr-TAC; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
|---|---|---|---|
| Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
| Authors | Roy J, Mallick B. | ||