Loading...
piRBase Id | piR-hsa-478 | Accession | DQ570169 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | AAGGTGGACGGCGGTGGCGGCGGTGGCG | Number of papers | 3 |
Length | 28 | Golden piRNA | - |
Aliases | piR-30281; PIR31280; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
300 | GSM2222674 | 18 | 29516567 | small RNA | neuroblastoma cell lines (IMR-32) |
301 | GSM2222675 | 31 | 29516567 | small RNA | neuroblastoma cell lines (SH-SY-5Y) |
304 | GSM4585037 | 42 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma) |
309 | GSM4585042 | 14 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma) |
311 | GSM4585044 | 2 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma) |
315 | GSM4585048 | 67 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma) |
316 | GSM4585049 | 26 | 32668808 | small RNA | Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 5:45695888-45695916:- | HCN1 ENST00000673735; HCN1 ENST00000303230; HCN1 ENST00000634658; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 29516567 | Journal | Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535. |
---|---|---|---|
Title | Investigating piwi-interacting RNA regulome in human neuroblastoma. | ||
Authors | Roy J, Mallick B. |
PubMed | 32668808 | Journal | Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954. |
---|---|---|---|
Title | Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients. | ||
Authors | Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL. |