Loading...

Detail Information of piRNA: piR-hsa-4249

General Information
piRBase Id piR-hsa-4249 Accession DQ573972
Organism Human Number of methods 2
Sequence TCCAAACTGAGGGTGTGAACTGTTGGT Number of papers 2
Length 27 Golden piRNA -
Aliases piR-42084; PIR35083;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
3 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 9:40298829-40298856:+ ENSG00000240240 ENST00000659103; ENSG00000240240 ENST00000654136; ENSG00000240240 ENST00000590154; ENSG00000240240 ENST00000421686; LTR ERVL-MaLR THE1D-int;
Location 2 9:64445053-64445080:+ LTR ERVL-MaLR THE1D-int;
Location 3 9:66077450-66077477:- ENSG00000286945 ENST00000668069; LTR ERVL-MaLR THE1D-int;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.