Loading...
piRBase Id | piR-hsa-395 | Accession | DQ570086 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | AAGACTTAGAGATGGAAAGTAGTTCAATGG | Number of papers | 3 |
Length | 30 | Golden piRNA | - |
Aliases | piR-30198; PIR31197; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
1 | N/A | N/A | 16751776 | small RNA | testis |
3 | N/A | 1 | 22313525 | small RNA | epididymis |
430 | GSM2067753 | 112 | 27068805 | small RNA | Seminal plasma(fertile healthy) |
431 | GSM2067754 | 1 | 27068805 | small RNA | Seminal plasma(asthenozoospermia) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 15:62245341-62245371:+ | ENSG00000166104 ENST00000562306; | SINE MIR MIRb; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22313525 | Journal | Gene. 2012 Apr 15;497(2):330-5. |
---|---|---|---|
Title | Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis. | ||
Authors | Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY. |
PubMed | 27068805 | Journal | Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229. |
---|---|---|---|
Title | Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility. | ||
Authors | Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X. |