Loading...

Detail Information of piRNA: piR-hsa-395

General Information
piRBase Id piR-hsa-395 Accession DQ570086
Organism Human Number of methods 1
Sequence AAGACTTAGAGATGGAAAGTAGTTCAATGG Number of papers 3
Length 30 Golden piRNA -
Aliases piR-30198; PIR31197;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
3 N/A 1 22313525 small RNA epididymis
430 GSM2067753 112 27068805 small RNA Seminal plasma(fertile healthy)
431 GSM2067754 1 27068805 small RNA Seminal plasma(asthenozoospermia)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 15:62245341-62245371:+ ENSG00000166104 ENST00000562306; SINE MIR MIRb;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22313525 Journal Gene. 2012 Apr 15;497(2):330-5.
Title Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Authors Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
PubMed 27068805 Journal Sci Rep. 2016 Apr 12;6:24229. doi: 10.1038/srep24229.
Title Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.
Authors Hong Y, Wang C, Fu Z, Liang H, Zhang S, Lu M, Sun W, Ye C, Zhang CY, Zen K, Shi L, Zhang C, Chen X.