Loading...

Detail Information of piRNA: piR-hsa-392

General Information
piRBase Id piR-hsa-392 Accession DQ570083
Organism Human Number of methods 2
Sequence AAGACATGGGCTGTGTCAACTCAGGGT Number of papers 2
Length 27 Golden piRNA -
Aliases piR-30195; PIR31194;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
175 GSM1584529 1 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
6 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 1:120424900-120424927:+ NBPF8 ENST00000652355; LTR ERVK LTR5_Hs;
Location 2 1:144451689-144451716:- NBPF15 ENST00000577412; NBPF15 ENST00000581897; NBPF15 ENST00000488031; NBPF15 ENST00000584793; NBPF15 ENST00000579734; NBPF15 ENST00000478419; NBPF15 ENST00000584575; NBPF15 ENST00000578953; LTR ERVK LTR5_Hs;
Location 3 1:145415668-145415695:- LTR ERVK LTR5_Hs;
Location 4 1:146948462-146948489:+ NBPF12 ENST00000617931; LTR ERVK LTR5_Hs;
Location 5 1:148138628-148138655:- NBPF11 ENST00000615281; NBPF11 ENST00000682118; NBPF11 ENST00000614506; LTR ERVK LTR5_Hs;
Location 6 1:149093672-149093699:- NBPF9 ENST00000615421; NBPF9 ENST00000621645; LTR ERVK LTR5_Hs;
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0.4447
GSM1584530 0.4909
GSM1584531 0.1228
GSM1584532 0
The Expression of piRNA: piR-hsa-392
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.