Loading...

Detail Information of piRNA: piR-hsa-3586

General Information
piRBase Id piR-hsa-3586 Accession DQ573293
Organism Human Number of methods 1
Sequence TCACTTGAACCCAGGAGGCGGAGGTTGCAGTG Number of papers 4
Length 32 Golden piRNA -
Aliases piR-41405; PIR34404;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
300 GSM2222674 89 29516567 small RNA neuroblastoma cell lines (IMR-32)
301 GSM2222675 232 29516567 small RNA neuroblastoma cell lines (SH-SY-5Y)
302 GSM4585035 38 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
304 GSM4585037 41 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
305 GSM4585038 67 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
307 GSM4585040 107 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
308 GSM4585041 41 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
309 GSM4585042 130 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
310 GSM4585043 111 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
311 GSM4585044 239 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
312 GSM4585045 85 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioblastoma, Grade IV astrocytoma)
314 GSM4585047 42 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
315 GSM4585048 27 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
316 GSM4585049 67 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
318 GSM4585051 44 32668808 small RNA Brain, Neurosurgical fluid, Extracellular Vesicles(Glioma, Grade II-III astrocytoma)
321 GSM4020158 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Monolayer culture control
323 GSM4020160 3 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Monolayer culture control
325 GSM4020162 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Monolayer culture contr
326 GSM4020163 2 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
327 GSM4020164 2 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Osteogenic differentiatio
329 GSM4020166 3 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Osteogenic differentiatio
330 GSM4020167 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
331 GSM4020168 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Osteogenic differentiat
332 GSM4020169 2 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
333 GSM4020170 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Pellet culture control (d
334 GSM4020171 5 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
335 GSM4020172 1 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Pellet culture control (d
336 GSM4020173 5 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
337 GSM4020174 3 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Pellet culture control
338 GSM4020175 4 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
339 GSM4020176 4 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 59 years; Male; Chondrogenic differentiat
340 GSM4020177 4 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
341 GSM4020178 5 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 80 years; Male; Chondrogenic differentiat
342 GSM4020179 8 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
343 GSM4020180 2 32050423 small RNA mesenchymal stromal cells from bone marrow (vertebra)(age: 55 years; Female; Chondrogenic differenti
Location in GRCh38
4011 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 13:28105605-28105637:+ SINE Alu AluSg;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 29516567 Journal Genes Chromosomes Cancer. 2018 Jul;57(7):339-349. doi: 10.1002/gcc.22535.
Title Investigating piwi-interacting RNA regulome in human neuroblastoma.
Authors Roy J, Mallick B.
PubMed 32668808 Journal Int J Mol Sci. 2020 Jul 13;21(14):4954. doi: 10.3390/ijms21144954.
Title Deep Sequencing of Small RNAs from Neurosurgical Extracellular Vesicles Substantiates miR-486-3p as a Circulating Biomarker that Distinguishes Glioblastoma from Lower-Grade Astrocytoma Patients.
Authors Hallal S, Ebrahim Khani S, Wei H, Lee MYT, Sim HW, Sy J, Shivalingam B, Buckland ME, Alexander-Kaufman KL.
PubMed 32050423 Journal Cells. 2020 Feb 9;9(2):398. doi: 10.3390/cells9020398.
Title Differential Regulation of circRNA, miRNA, and piRNA during Early Osteogenic and Chondrogenic Differentiation of Human Mesenchymal Stromal Cells.
Authors Della Bella E, Menzel U, Basoli V, Tourbier C, Alini M, Stoddart MJ.