Loading...

Detail Information of piRNA: piR-hsa-35391

General Information
piRBase Id piR-hsa-35391 Accession N/A
Organism Human Number of methods 2
Sequence CCCCCCACAACCGCGCTTGACTAGCTTGC Number of papers 1
Length 29 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 7 25818294 small RNA adult ovary
168 GSM1584522 6 25818294 small RNA adult ovary
169 GSM1584523 55 25818294 oxidized small RNA adult ovary
170 GSM1584524 35 25818294 oxidized small RNA adult ovary
171 GSM1584525 25 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 34 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 42 25818294 oxidized small RNA ovary from 1st trimester embryos
174 GSM1584528 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 4 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 6 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 13 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 7:148941536-148941565:+ ENSG00000286171 ENST00000651540; scRNA scRNA HY5;
piRNA Expression
Sample CPM
GSM1584521 6.291
GSM1584522 4.1419
GSM1584523 52.3484
GSM1584524 30.5206
GSM1584525 15.7687
GSM1584526 22.0136
Sample CPM
GSM1584527 60.4117
GSM1584528 106.4623
GSM1584529 1.779
GSM1584530 2.9452
GSM1584531 1.5964
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-35391
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.