Loading...

Detail Information of piRNA: piR-hsa-3506

General Information
piRBase Id piR-hsa-3506 Accession DQ573213
Organism Human Number of methods 2
Sequence TCACTCTTGAGCCTTGGCCTAGTGAAT Number of papers 3
Length 27 Golden piRNA -
Aliases piR-41325; PIR34324;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
177 GSM1584531 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
269 GSM3517638 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
272 GSM3517642 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
274 GSM3517644 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
275 GSM3517645 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
278 GSM3517648 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
288 GSM3517673 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10131808-10131835:+
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0.1228
GSM1584532 0
The Expression of piRNA: piR-hsa-3506
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.