Loading...

Detail Information of piRNA: piR-hsa-34765

General Information
piRBase Id piR-hsa-34765 Accession N/A
Organism Human Number of methods 2
Sequence TCCTTGTGGGAACAGAGCACATGGCAGCC Number of papers 2
Length 29 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
273 GSM3517643 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
274 GSM3517644 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
275 GSM3517645 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
276 GSM3517646 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
278 GSM3517648 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
284 GSM3517669 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
287 GSM3517672 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
288 GSM3517673 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:77248986-77249015:+ CCNG2 ENST00000497512; CCNG2 ENST00000514756; DNA TcMar-Tigger MERX;
piRNA Expression
The Expression of piRNA: piR-hsa-34765
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.