Loading...

Detail Information of piRNA: piR-hsa-34489

General Information
piRBase Id piR-hsa-34489 Accession N/A
Organism Human Number of methods 2
Sequence TCGAGGTGAAGTATATTTGATATAAGAC Number of papers 2
Length 28 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 3 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
265 GSM3517634 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
267 GSM3517636 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
271 GSM3517641 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
276 GSM3517646 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
283 GSM3517668 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10321393-10321421:+
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0.4909
GSM1584531 0.3684
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-34489
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.