Loading...

Detail Information of piRNA: piR-hsa-3435

General Information
piRBase Id piR-hsa-3435 Accession DQ573142
Organism Human Number of methods 2
Sequence TCACCTTAGGTTGTACAGATTGTATTGGTC Number of papers 3
Length 30 Golden piRNA Y
Aliases piR-41254; PIR34253;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
169 GSM1584523 2 25818294 oxidized small RNA adult ovary
175 GSM1584529 2 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 3 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 24 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
265 GSM3517634 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
267 GSM3517636 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
287 GSM3517672 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10143619-10143649:+ ENSG00000250393 ENST00000511779;
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 1.9036
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0.8895
GSM1584530 1.4726
GSM1584531 2.9471
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-3435
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.