Loading...

Detail Information of piRNA: piR-hsa-34082

General Information
piRBase Id piR-hsa-34082 Accession N/A
Organism Human Number of methods 2
Sequence TGCCGTGATCGTATAGTGGTTAGTACTCTGCG Number of papers 1
Length 32 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 59 25818294 small RNA adult ovary
168 GSM1584522 65 25818294 small RNA adult ovary
169 GSM1584523 410 25818294 oxidized small RNA adult ovary
170 GSM1584524 206 25818294 oxidized small RNA adult ovary
171 GSM1584525 7 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 5 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 5 25818294 oxidized small RNA ovary from 1st trimester embryos
174 GSM1584528 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 33 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 63 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 24 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
2 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 6:27158125-27158157:+ tRNA tRNA tRNA-His-CAY_;
Location 2 9:14433980-14434012:- ENSG00000287708 ENST00000659981; tRNA tRNA tRNA-His-CAY_;
piRNA Expression
Sample CPM
GSM1584521 53.0243
GSM1584522 44.8704
GSM1584523 390.2335
GSM1584524 179.6356
GSM1584525 4.4152
GSM1584526 3.2373
Sample CPM
GSM1584527 7.1919
GSM1584528 106.4623
GSM1584529 14.6765
GSM1584530 30.9251
GSM1584531 2.9471
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-34082
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.