Loading...
piRBase Id | piR-hsa-33773 | Accession | N/A |
---|---|---|---|
Organism | Human | Number of methods | 2 |
Sequence | AACAGCCTCTGGCATGTTGGAACAATGTAG | Number of papers | 1 |
Length | 30 | Golden piRNA | - |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
167 | GSM1584521 | 2 | 25818294 | small RNA | adult ovary |
168 | GSM1584522 | 15 | 25818294 | small RNA | adult ovary |
169 | GSM1584523 | 5 | 25818294 | oxidized small RNA | adult ovary |
170 | GSM1584524 | 16 | 25818294 | oxidized small RNA | adult ovary |
171 | GSM1584525 | 26 | 25818294 | small RNA | ovary from 1st trimester embryos |
172 | GSM1584526 | 46 | 25818294 | small RNA | ovary from 1st trimester embryos |
173 | GSM1584527 | 7 | 25818294 | oxidized small RNA | ovary from 1st trimester embryos |
174 | GSM1584528 | 1 | 25818294 | oxidized small RNA | ovary from 1st trimester embryos |
175 | GSM1584529 | 6 | 25818294 | small RNA | ovary from 2nd trimester embryos |
176 | GSM1584530 | 27 | 25818294 | small RNA | ovary from 2nd trimester embryos |
177 | GSM1584531 | 4 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 21:8216687-8216717:+ | ENSG00000278996 ENST00000623664; | rRNA rRNA LSU-rRNA_Hsa; |
Location 2 | 21:8260916-8260946:+ | rRNA rRNA LSU-rRNA_Hsa; | |
Location 3 | 21:8399721-8399751:+ | ENSG00000280441 ENST00000623860; ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; ENSG00000280441 ENST00000651958; | rRNA rRNA LSU-rRNA_Hsa; |
Location 4 | 21:8443956-8443986:+ | ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; | rRNA rRNA LSU-rRNA_Hsa; |
Location 5 | CHR_HG2513_PATCH:8757817-8757847:+ | ||
Location 6 | CHR_HG2513_PATCH:8802052-8802082:+ | ||
Location 7 | GL000220.1:116158-116188:+ | ||
Location 8 | GL000220.1:160130-160160:+ | ||
Location 9 | KI270733.1:133013-133043:+ | ||
Location 10 | KI270733.1:178092-178122:+ |
Sample | CPM |
---|---|
GSM1584521 | 1.7974 |
GSM1584522 | 10.3547 |
GSM1584523 | 4.7589 |
GSM1584524 | 13.9523 |
GSM1584525 | 16.3994 |
GSM1584526 | 29.7832 |
Sample | CPM |
---|---|
GSM1584527 | 10.0686 |
GSM1584528 | 106.4623 |
GSM1584529 | 2.6684 |
GSM1584530 | 13.2536 |
GSM1584531 | 0.4912 |
GSM1584532 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 25818294 | Journal | Cell Rep. 2015 Mar 31;10(12):2069-82. |
---|---|---|---|
Title | Piwi proteins and piRNAs in mammalian oocytes and early embryos. | ||
Authors | Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF. |