Loading...

Detail Information of piRNA: piR-hsa-33425

General Information
piRBase Id piR-hsa-33425 Accession N/A
Organism Human Number of methods 2
Sequence CGGGTTGCTTGGGAATGCAGCCCAAAGCGGGT Number of papers 1
Length 32 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
168 GSM1584522 6 25818294 small RNA adult ovary
169 GSM1584523 9 25818294 oxidized small RNA adult ovary
170 GSM1584524 34 25818294 oxidized small RNA adult ovary
171 GSM1584525 52 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 36 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 54 25818294 oxidized small RNA ovary from 1st trimester embryos
174 GSM1584528 2 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 6 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 38 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 12 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
11 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 21:8441426-8441458:+ ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; rRNA rRNA LSU-rRNA_Hsa;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 4.1419
GSM1584523 8.5661
GSM1584524 29.6486
GSM1584525 32.7989
GSM1584526 23.3086
Sample CPM
GSM1584527 77.6721
GSM1584528 212.9245
GSM1584529 2.6684
GSM1584530 18.6532
GSM1584531 1.4736
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-33425
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.