Loading...

Detail Information of piRNA: piR-hsa-33377

General Information
piRBase Id piR-hsa-33377 Accession N/A
Organism Human Number of methods 2
Sequence TTCATGCCCAGAAGCTGTTGCAGACTC Number of papers 2
Length 27 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
168 GSM1584522 3 25818294 small RNA adult ovary
169 GSM1584523 8 25818294 oxidized small RNA adult ovary
170 GSM1584524 12 25818294 oxidized small RNA adult ovary
175 GSM1584529 3 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 6 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
283 GSM3517668 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10208550-10208577:+
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 2.0709
GSM1584523 7.6143
GSM1584524 10.4642
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 1.3342
GSM1584530 0.4909
GSM1584531 0.7368
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-33377
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.