Loading...

Detail Information of piRNA: piR-hsa-33247

General Information
piRBase Id piR-hsa-33247 Accession N/A
Organism Human Number of methods 2
Sequence TTGATTCTGTTTGAGTCAGACTGCTCGTTT Number of papers 2
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
169 GSM1584523 1 25818294 oxidized small RNA adult ovary
170 GSM1584524 1 25818294 oxidized small RNA adult ovary
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
269 GSM3517638 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
279 GSM3517649 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 8:139128335-139128365:+ LTR ERVL ERVL-B4-int;
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 0
GSM1584523 0.9518
GSM1584524 0.872
GSM1584525 0
GSM1584526 0
The Expression of piRNA: piR-hsa-33247
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.