Loading...

Detail Information of piRNA: piR-hsa-33154

General Information
piRBase Id piR-hsa-33154 Accession N/A
Organism Human Number of methods 2
Sequence TTTTGGTGATGACTTAGATGCATTGGGAGGC Number of papers 2
Length 31 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 3 25818294 small RNA adult ovary
265 GSM3517634 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
269 GSM3517638 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
273 GSM3517643 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
280 GSM3517660 N/A 31358756 IP Input oocyte(age: adult)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
287 GSM3517672 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
288 GSM3517673 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 8:139498574-139498605:+
piRNA Expression
Sample CPM
GSM1584521 2.6961
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-33154
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.