Loading...

Detail Information of piRNA: piR-hsa-33000

General Information
piRBase Id piR-hsa-33000 Accession N/A
Organism Human Number of methods 2
Sequence TTGGCAACACCATCAGACACATCTAGCAAC Number of papers 2
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 1 25818294 small RNA adult ovary
177 GSM1584531 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
271 GSM3517641 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
276 GSM3517646 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10236368-10236398:+ LTR ERVL MLT2A2;
piRNA Expression
Sample CPM
GSM1584521 0.8987
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0
GSM1584530 0
GSM1584531 0.1228
GSM1584532 0
The Expression of piRNA: piR-hsa-33000
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.