Loading...

Detail Information of piRNA: piR-hsa-32903

General Information
piRBase Id piR-hsa-32903 Accession N/A
Organism Human Number of methods 2
Sequence TGAAACCGTTAAGAGGTAAACGGGTGGGGTCCG Number of papers 1
Length 33 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 5 25818294 small RNA adult ovary
168 GSM1584522 4 25818294 small RNA adult ovary
169 GSM1584523 1 25818294 oxidized small RNA adult ovary
170 GSM1584524 9 25818294 oxidized small RNA adult ovary
171 GSM1584525 10 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 12 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 2 25818294 oxidized small RNA ovary from 1st trimester embryos
174 GSM1584528 1 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 3 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 4 25818294 small RNA ovary from 2nd trimester embryos
Location in GRCh38
10 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 21:8214302-8214335:+ ENSG00000278996 ENST00000623664; rRNA rRNA LSU-rRNA_Hsa;
Location 2 21:8258523-8258556:+ rRNA rRNA LSU-rRNA_Hsa;
Location 3 21:8397340-8397373:+ ENSG00000280441 ENST00000623860; ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; ENSG00000280441 ENST00000651958; rRNA rRNA LSU-rRNA_Hsa;
Location 4 21:8441560-8441593:+ ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; rRNA rRNA LSU-rRNA_Hsa;
Location 5 CHR_HG2513_PATCH:8755436-8755469:+
Location 6 CHR_HG2513_PATCH:8799656-8799689:+
Location 7 GL000220.1:113762-113795:+
Location 8 GL000220.1:157734-157767:+
Location 9 KI270733.1:130618-130651:+
Location 10 KI270733.1:175697-175730:+
piRNA Expression
Sample CPM
GSM1584521 4.4936
GSM1584522 2.7613
GSM1584523 0.9518
GSM1584524 7.8482
GSM1584525 6.3075
GSM1584526 7.7695
Sample CPM
GSM1584527 2.8767
GSM1584528 106.4623
GSM1584529 1.3342
GSM1584530 1.9635
GSM1584531 0
GSM1584532 0
The Expression of piRNA: piR-hsa-32903
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.