Loading...

Detail Information of piRNA: piR-hsa-32898

General Information
piRBase Id piR-hsa-32898 Accession N/A
Organism Human Number of methods 2
Sequence CGTACGACTCTTAGCGGTGGATCACT Number of papers 1
Length 26 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 181 25818294 small RNA adult ovary
168 GSM1584522 245 25818294 small RNA adult ovary
169 GSM1584523 161 25818294 oxidized small RNA adult ovary
170 GSM1584524 187 25818294 oxidized small RNA adult ovary
171 GSM1584525 83 25818294 small RNA ovary from 1st trimester embryos
172 GSM1584526 94 25818294 small RNA ovary from 1st trimester embryos
173 GSM1584527 53 25818294 oxidized small RNA ovary from 1st trimester embryos
174 GSM1584528 2 25818294 oxidized small RNA ovary from 1st trimester embryos
175 GSM1584529 284 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 806 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 462 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 123 25818294 oxidized small RNA ovary from 2nd trimester embryos
Location in GRCh38
10 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 21:8212566-8212592:+ ENSG00000278996 ENST00000623664; RNA5-8SN2 ENST00000612463;
Location 2 21:8256775-8256801:+ 5_8S_rRNA ENST00000610460;
Location 3 21:8395601-8395627:+ ENSG00000280441 ENST00000623860; ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; ENSG00000280441 ENST00000651958; RNA5-8SN3 ENST00000613359;
Location 4 21:8439817-8439843:+ ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; RNA5-8SN1 ENST00000619471;
Location 5 CHR_HG2513_PATCH:8753697-8753723:+
Location 6 CHR_HG2513_PATCH:8797913-8797939:+
Location 7 GL000220.1:112019-112045:+ RNA5-8SN5 ENST00000611446;
Location 8 GL000220.1:155991-156017:+ 5_8S_rRNA ENST00000619779;
Location 9 KI270733.1:128871-128897:+ RNA5-8SN4 ENST00000616292;
Location 10 KI270733.1:173950-173976:+ 5_8S_rRNA ENST00000618998;
piRNA Expression
Sample CPM
GSM1584521 162.6677
GSM1584522 169.1271
GSM1584523 153.238
GSM1584524 163.0673
GSM1584525 52.3521
GSM1584526 60.8612
Sample CPM
GSM1584527 76.2338
GSM1584528 212.9245
GSM1584529 126.3064
GSM1584530 395.6448
GSM1584531 56.7319
GSM1584532 154.3032
The Expression of piRNA: piR-hsa-32898
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.