Loading...
piRBase Id | piR-hsa-32898 | Accession | N/A |
---|---|---|---|
Organism | Human | Number of methods | 2 |
Sequence | CGTACGACTCTTAGCGGTGGATCACT | Number of papers | 1 |
Length | 26 | Golden piRNA | Y |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
167 | GSM1584521 | 181 | 25818294 | small RNA | adult ovary |
168 | GSM1584522 | 245 | 25818294 | small RNA | adult ovary |
169 | GSM1584523 | 161 | 25818294 | oxidized small RNA | adult ovary |
170 | GSM1584524 | 187 | 25818294 | oxidized small RNA | adult ovary |
171 | GSM1584525 | 83 | 25818294 | small RNA | ovary from 1st trimester embryos |
172 | GSM1584526 | 94 | 25818294 | small RNA | ovary from 1st trimester embryos |
173 | GSM1584527 | 53 | 25818294 | oxidized small RNA | ovary from 1st trimester embryos |
174 | GSM1584528 | 2 | 25818294 | oxidized small RNA | ovary from 1st trimester embryos |
175 | GSM1584529 | 284 | 25818294 | small RNA | ovary from 2nd trimester embryos |
176 | GSM1584530 | 806 | 25818294 | small RNA | ovary from 2nd trimester embryos |
177 | GSM1584531 | 462 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
178 | GSM1584532 | 123 | 25818294 | oxidized small RNA | ovary from 2nd trimester embryos |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 21:8212566-8212592:+ | ENSG00000278996 ENST00000623664; RNA5-8SN2 ENST00000612463; | |
Location 2 | 21:8256775-8256801:+ | 5_8S_rRNA ENST00000610460; | |
Location 3 | 21:8395601-8395627:+ | ENSG00000280441 ENST00000623860; ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; ENSG00000280441 ENST00000651958; RNA5-8SN3 ENST00000613359; | |
Location 4 | 21:8439817-8439843:+ | ENSG00000280441 ENST00000651813; ENSG00000280441 ENST00000652379; RNA5-8SN1 ENST00000619471; | |
Location 5 | CHR_HG2513_PATCH:8753697-8753723:+ | ||
Location 6 | CHR_HG2513_PATCH:8797913-8797939:+ | ||
Location 7 | GL000220.1:112019-112045:+ | RNA5-8SN5 ENST00000611446; | |
Location 8 | GL000220.1:155991-156017:+ | 5_8S_rRNA ENST00000619779; | |
Location 9 | KI270733.1:128871-128897:+ | RNA5-8SN4 ENST00000616292; | |
Location 10 | KI270733.1:173950-173976:+ | 5_8S_rRNA ENST00000618998; |
Sample | CPM |
---|---|
GSM1584521 | 162.6677 |
GSM1584522 | 169.1271 |
GSM1584523 | 153.238 |
GSM1584524 | 163.0673 |
GSM1584525 | 52.3521 |
GSM1584526 | 60.8612 |
Sample | CPM |
---|---|
GSM1584527 | 76.2338 |
GSM1584528 | 212.9245 |
GSM1584529 | 126.3064 |
GSM1584530 | 395.6448 |
GSM1584531 | 56.7319 |
GSM1584532 | 154.3032 |
No record. |
No record. |
No record. |
No record. |
PubMed | 25818294 | Journal | Cell Rep. 2015 Mar 31;10(12):2069-82. |
---|---|---|---|
Title | Piwi proteins and piRNAs in mammalian oocytes and early embryos. | ||
Authors | Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF. |