Loading...

Detail Information of piRNA: piR-hsa-32891

General Information
piRBase Id piR-hsa-32891 Accession N/A
Organism Human Number of methods 3
Sequence TTCATGGAGATGGTGCAGTTGAGCTCTT Number of papers 2
Length 28 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
167 GSM1584521 4 25818294 small RNA adult ovary
168 GSM1584522 7 25818294 small RNA adult ovary
169 GSM1584523 25 25818294 oxidized small RNA adult ovary
170 GSM1584524 33 25818294 oxidized small RNA adult ovary
175 GSM1584529 2 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 1 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 12 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 1 25818294 oxidized small RNA ovary from 2nd trimester embryos
266 GSM3517635 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
267 GSM3517636 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
269 GSM3517638 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
270 GSM3517639 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
272 GSM3517642 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
282 GSM3517667 N/A 31358756 HIWI3 IP oocyte(age: adult; spike in)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
287 GSM3517672 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
288 GSM3517673 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10144987-10145015:+
piRNA Expression
Sample CPM
GSM1584521 3.5949
GSM1584522 4.8322
GSM1584523 23.7947
GSM1584524 28.7766
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 0.8895
GSM1584530 0.4909
GSM1584531 1.4736
GSM1584532 1.2545
The Expression of piRNA: piR-hsa-32891
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.