Loading...
piRBase Id | piR-hsa-3214 | Accession | DQ572906 |
---|---|---|---|
Organism | Human | Number of methods | 1 |
Sequence | TCACACATCTGGTGAGGTCGTTAGAAGGT | Number of papers | 1 |
Length | 29 | Golden piRNA | - |
Aliases | piR-41018; PIR34017; |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 1:1564331-1564360:- | SSU72 ENST00000291386; SSU72 ENST00000378725; SSU72 ENST00000359060; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |