Loading...

Detail Information of piRNA: piR-hsa-31124

General Information
piRBase Id piR-hsa-31124 Accession DQ600838
Organism Human Number of methods 2
Sequence TAGACAAGGTAAAGAATTAAGTGCTGT Number of papers 3
Length 27 Golden piRNA Y
Aliases piR-38904; PIR61949;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
175 GSM1584529 42 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 26 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 570 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 37 25818294 oxidized small RNA ovary from 2nd trimester embryos
265 GSM3517634 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
Location in GRCh38
49 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:16077324-16077351:- PROM1 ENST00000505450; PROM1 ENST00000447510; PROM1 ENST00000508167; PROM1 ENST00000510224; PROM1 ENST00000513946; PROM1 ENST00000539194; PROM1 ENST00000508322; PROM1 ENST00000508940; PROM1 ENST00000514967; PROM1 ENST00000504842; PROM1 ENST00000513108; PROM1 ENST00000502501; PROM1 ENST00000514693; PROM1 ENST00000512304; LTR ERVK LTR5_Hs;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 18.6791
GSM1584530 12.7627
GSM1584531 69.9939
GSM1584532 46.4164
The Expression of piRNA: piR-hsa-31124
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.